Loading...

CalculatePanelMoje obliczeniaForecastChat
HD Matrix
Oblicz
Moje obliczenia
Prognoza dzienna
Asystent AI
Kompozyt
Test Kompatybilnosci
Randki
Porównaj
Zespół
Rodzina
Rodzice
Poczęcie
Porównanie profili
Nauka
Kurs
Początkujący
Typy
Profile HD
64 Bramy
Kanały HD
Centra HD
Autorytety HD
Przewodnik po Autorytecie
Słownik
FAQ
Quiz
Zasoby
Kalendarz
Planer Tygodnia
Cykle
Cykle Predykcyjne
Analiza Decyzji
Dekondycjonowanie
Praca z Cieniem
Eksperyment
Rektyfikacja
I Ching
Krzyż inkarnacji
Dziennik GK
Postac
Mapa Osobowosci
2027
Czat
Blog
Opinie
Znane osoby
Statystyki znanych
Statystyki
O nas
Wesprzyj
Cennik
Wideo
💎

Oferta założycielska

Premium od $5+

HD MatrixHD Matrix
Odkryj
Logowanie
Gene Keys/Gene Key 40

GENE KEY 40

Exhaustion → Resolve → Divine Will

Gene Key 40 moves from the Shadow of "Exhaustion" through the Gift of "Resolve" to the Siddhi of "Divine Will" — the same theme expressed at three frequencies of consciousness, from fear to awakening.

Gene Key 40 — Resolve

The Path of Transformation

ShadowExhaustion

Exhaustion from excessive giving. Loneliness from inability to accept support.

GiftResolve

Resolve in establishing boundaries and balance between giving and receiving.

SiddhiDivine Will

Divine Will — a state where your will and the higher will become one.

GENE KEY 40: THE WILL TO SURRENDER

Spectrum: Exhaustion → Resolve → Divine Will THE SHADOW — Exhaustion

FANTASY

THE GENETIC WHEEL OF SAMSARA

The 415 Gene Key and its various frequencies comprise a truly remarkable archetype. It stands alone within the human genetic matrix with a very important function. It relates to what is known in genetics as the start codon. Since this is such an important Gene Key it may help to understand exactly what it means. Below is an example of a section of genetic code transcribed into letters. The genetic code is made up of combinations of only four letters A, T, C and G. These letters are called bases and represent the basic building blocks of the entire code. Hidden within these billions of letters are specific instructions for the body to follow. In deciphering the code of life, scientists discovered that there were places within the sequence where the body always seemed to know to begin building. They found that whenever the body sees the letters atg in a sequence, it always acts on the instructions that follow. Thus they called this the start codon because it operates like a front door key into the code itself. caattgtcatacgacttgcagtgagcetcaggagcacetccaggaactcc tcagcagcgcctccttcagctccacagccagacgccctcagacagcaaag cctacccccgcgccgcgccctgcccgccectgcgatgctcgcccgcgccc tgctgctgtgcecgstcctgecectcagccatacagetgagtacctgecg ccgcgcaccgegesactccggttccacgcacccgggcagagtttccgctct From the above description, you should see how important this 415t Gene Key is. As a genetic archetype of functioning within human consciousness, its message is of huge import to us all. At the Shadow level of consciousness, the 415t Gene Key centres around the issue of fantasy and dreams. Being in the thrall of the 415' Shadow of Fantasy is like holding the key to your dreams in your hand, but never turning it in the lock. Whether you have this 415 Shadow in your Hologenetic Profile or not, you are undoubtedly available for its influence because like all the Shadows, it exerts its greatest power through the collective frequency of the planet. It is because of this 41' Shadow that our planet is populated by people who dream of a better life but who, for one reason or another, are unable to bring these dreams into reality. The 415 Shadow creates a continual pressure within humans; it is the pressure to evolve. When this pressure is distorted by a low frequency field, as is the current state of humanity, it becomes distorted into the pressure to feel happy. Thus begins what the ancients named the Wheel of Samsara — an endless cycle of suffering in which humans become trapped by the need to satisfy their desires. With the mass distortion of the 415' Shadow, it is as though the body of humanity has misread the instructions left within its collective DNA. It all begins here, in this Gene Key. It is not desire itself that is the problem, because desire (the 30¢h shadow) comes after Fantasy. Fantasy is the spark that ignites the fuel of the desire. Over half of your genetic code derives from other organisms from an earlier evolution. So how is it that we h... THE GIFT — Resolve

Corresponding Gate in Human Design
Gate 40 →
Programming Partner
Gene Key 39 →

What are the Gene Keys?

Gene Keys is a system of consciousness transformation created by Richard Rudd, based on Human Design, I Ching, and genetics. Each of the 64 Gene Keys corresponds to a Human Design Gate and describes a spectrum of consciousness from Shadow (low frequency) through Gift (middle) to Siddhi (highest frequency).

← All 64 Gene Keys
BasicsTypesAuthorityProfilesCentersChannelsGatesRelationshipsTransitsCareerGene KeysHealth
H
HD Matrix

Platforma samopoznania oparta na Human Design. Obliczaj, analizuj, ucz się.

[email protected]

Główne

  • Kalkulator
  • Kompozyt
  • Test Kompatybilnosci
  • Porównaj
  • Prognoza dzienna
  • Kalendarz

Nauka

  • Nauka
  • Początkujący
  • Typy
  • Słownik
  • Blog
  • FAQ
  • Quiz
  • Porównanie profili
  • Przewodnik po Autorytecie
  • Zasoby

Narzędzia

  • Cykle
  • Cykle Predykcyjne
  • Eksperyment
  • Dekondycjonowanie
  • Planer Tygodnia
  • Analiza Decyzji
  • I Ching
  • 2027
  • Statystyki

Społeczność

  • Czat
  • Randki
  • Opinie
  • Znane osoby
  • Statystyki znanych
  • Co nowego
  • O nas
  • Współpraca

Konto

  • Cennik
  • Panel
  • Mój Design
  • Osiagniecia
  • Wyzwania
  • Asystent AI
  • Postac
  • Kontakt
  • Wesprzyj

© 2026 HD Matrix Pro. Wszelkie prawa zastrzeżone.

Opinie|Kontakt|O nas|Privacy|Terms|Konto
💛Podoba Ci się HD Matrix Pro?Wesprzyj projekt
☕Postaw mi kawę ☕

ANTICIPATION

THE RING OF ORIGIN

As we saw with the 415t Shadow, this Gene Key represents the basic pressure to evolve — to seek out new pastures and new experiences. This evolutionary impulse is the secret to the 41' Gift — the Gift of Anticipation. There is an interesting phenomenon that occurs the more you raise the frequency passing in and out of your DNA. You become more and more sensitive to the hidden properties in the world around you. One of the things you become particularly aware of is the presence of morphogenetic fields. Morphogenetic fields were first postulated by the scientist Rupert Sheldrake, but many older cultures have spoken of such energy fields throughout history. Essentially, a morphogenetic field is an invisible energy grid that communicates specific information across time and space. Depending on your sensitivity, you can pick up information about the past or the future from the field. The 41 Gift is a particularly special Gift. As higher frequencies begin to operate through this Gene Key, it picks up very specific information from the morphogenetic field. Every one of the 64 Gene Keys operates out of a particular morphogenetic field. For example, the programming partner of this Gift, the 31' Gift of Leadership, attunes itself to all higher frequency leaders on this planet, even inspirational leaders from our collective past. Each Gene Key draws strength and power from those who have come before and, at the same time, also attunes to those who have not yet been born. It may explain why certain people seem to have premonitions about the future. Both of these Gifts — Anticipation (41) and Leadership (31) — operate together, one reinforcing the other. The greatest leaders are those who build upon the past and anticipate what is coming. Likewise, people with the Gift of Anticipation are naturally held up as leaders. The 41 Gift has a single genetic agenda — it is always attuned to the next evolutionary energetic grid that is waiting to descend into form. Behind it are hidden the blueprints of evolution itself. Which blueprint it picks up depends upon the level of frequency and the person’s cultural conditioning and geography. We pick up different blueprints in different places, and as our frequency rises, the more details we see. Premonitions sometimes occur to people when their body receives a sudden surge of frequency through a shock or through being in a particular place with a very strong morphogenetic field. Most occult phenomena are the result of sudden electromagnetic surges through the 41‘t Gene Key. These impulses are often misinterpreted when the surge quickly dies back and the Shadow frequency regains its grip on the vehicle. The mind paints its own fantasy of what it just experienced and people can interpret these sensations and impressions in very diverse ways, from ghosts to past lives. It is the difference between genius and non-genius. Genius manifests whilst non-genius dreams. When you are able to maint... THE SIDDHI — Divine Will

DIVINE WILL

COMPLETE PHYSICAL RELAXATION

At the highest frequencies, the Gift of Resolve becomes transformed into pure Divine Will. In many mystical pantheons, the qualities of the divine are divided into three main cosmic organs — the Divine Mind, the Divine Heart and the Divine Will. Of these three, Divine Will is usually seen as the primary faculty out of which the other two emerge. The entire notion of the existence of a Divine Will is an aspect of humanity’s need to know that there is some kind of beneficial force that controls the universe. In other words, this 40' siddhi actually concerns our perception of the existence of God. Two polarities within our genetics — the 37'" and the 40‘ Gene Keys — form the bedrock of our beliefs and experience concerning the existence of a higher power. If we look at the 37" siddhi of Tenderness, we can see that all those who have attained realisation through the 37' siddhi have left an imprint within the collective psyche of humanity concerning the nature of the divine, and this imprint reflects a deeply tender and loving force underlying all creation. This tenderness is reflected in all mythologies and world religions that see the divine force as either a mother or father figure. In this view we humans are seen as the children of God. However, when you look through the 40‘ siddhi you see an entirely different picture, one that has caused great confusion amongst mystical seekers for millennia. Masters who have attained the 40‘ siddhi are the great mystical deniers of God. Just as the 40t Shadow denies its own or other’s needs, the 40'" siddhi denies humanity’s need for a God in the first place. This is an extremely powerful expression of the siddhic state because whenever it appears in the world it essentially throws human seekers into a panic! When a man or woman has attained the ultimate siddhic state known as enlightenment, an undeniable energy emerges from them — the pure energy of consciousness itself. Such people speak with great power. Humanity’s collective need to know that God exists is actually a need based on our deepest fear — the fear that we are alone in a Godless universe. When the 40" siddhi expresses its divinity it ironically does so by denying the existence of any separation between humanity and divinity. In doing this, the 40' siddhi forces humans to confront one of the great problems of seekers — that the seeking itself gets in the way of ultimate realisation. If someone attains the siddhic state through this 40" Gene Key they will have done it in spite of God. This is the path of the mystical denial of the need for help from a God. Such people will follow no other teaching or master but will travel their path absolutely alone. When they attain to the highest state, they will often speak about it in the terms of their denial. When the 40 siddhi speaks, it will say that there is no path to God because there is no God outside of your aloneness. They may say that all holy practices a... Programming Partner: 31

Powiązane artykuły

All articles: Gates →
Lewy Krzyż Planowania (brama 40)W Rave Mandala Krzyż Wcielenia jest podstawową sygnaturą celu życiowego – czterech bram objawionych przez świadome (osobowość) Słońce i Ziemię, jKątowy krzyż planowania — brama 40 (Samotność)Kątowy Krzyż Planowania jest wcieleniem Kanału Społeczności (40–37) zakotwiczonego w Kanale Otwartości (22–12). Jego kompozycja bramyPrzejście przez bramkę 40 (samotność): co aktywuje każdegoBrama 40 to element plemiennego obwodu znajdujący się w Centrum Serca/Woli, noszący nazwę Samotności, ale dokładniej opisany jako brama Wybawiciela.Brama 40, linia 5: Heretyk wybawieniaSzósta harmoniczna heksagramu Hsieh niesie rezonans uniwersalizacji na poziomie linii – projekcję osobistej, ciężko wywalczonej prawdy na zbiorowośćBrama 40, linia 2: Zwany PustelnikiemDruga linia Bramy Samotności to projektor, pustelnik i demokratyczny rezonans heksagramu – linia, która w najbardziej solidnym obwodzie Indywidualnego ObwoduBrama 40, wiersz 6: Samotność wzorca do naśladowaniaSzósty wiersz Bramy Samotności (Heksagram 40, Hsieh – Wybawienie) zawiera myśl przewodnią „Cel samotności” lub, w klasycznym tekście Wilhelma, t