GENE KEY 40
Exhaustion → Resolve → Divine Will
Gene Key 40 moves from the Shadow of "Exhaustion" through the Gift of "Resolve" to the Siddhi of "Divine Will" — the same theme expressed at three frequencies of consciousness, from fear to awakening.
The Path of Transformation
Exhaustion from excessive giving. Loneliness from inability to accept support.
Resolve in establishing boundaries and balance between giving and receiving.
Divine Will — a state where your will and the higher will become one.
GENE KEY 40: THE WILL TO SURRENDER
Spectrum: Exhaustion → Resolve → Divine Will THE SHADOW — Exhaustion
FANTASY
THE GENETIC WHEEL OF SAMSARA
The 415 Gene Key and its various frequencies comprise a truly remarkable archetype. It stands alone within the human genetic matrix with a very important function. It relates to what is known in genetics as the start codon. Since this is such an important Gene Key it may help to understand exactly what it means. Below is an example of a section of genetic code transcribed into letters. The genetic code is made up of combinations of only four letters A, T, C and G. These letters are called bases and represent the basic building blocks of the entire code. Hidden within these billions of letters are specific instructions for the body to follow. In deciphering the code of life, scientists discovered that there were places within the sequence where the body always seemed to know to begin building. They found that whenever the body sees the letters atg in a sequence, it always acts on the instructions that follow. Thus they called this the start codon because it operates like a front door key into the code itself. caattgtcatacgacttgcagtgagcetcaggagcacetccaggaactcc tcagcagcgcctccttcagctccacagccagacgccctcagacagcaaag cctacccccgcgccgcgccctgcccgccectgcgatgctcgcccgcgccc tgctgctgtgcecgstcctgecectcagccatacagetgagtacctgecg ccgcgcaccgegesactccggttccacgcacccgggcagagtttccgctct From the above description, you should see how important this 415t Gene Key is. As a genetic archetype of functioning within human consciousness, its message is of huge import to us all. At the Shadow level of consciousness, the 415t Gene Key centres around the issue of fantasy and dreams. Being in the thrall of the 415' Shadow of Fantasy is like holding the key to your dreams in your hand, but never turning it in the lock. Whether you have this 415 Shadow in your Hologenetic Profile or not, you are undoubtedly available for its influence because like all the Shadows, it exerts its greatest power through the collective frequency of the planet. It is because of this 41' Shadow that our planet is populated by people who dream of a better life but who, for one reason or another, are unable to bring these dreams into reality. The 415 Shadow creates a continual pressure within humans; it is the pressure to evolve. When this pressure is distorted by a low frequency field, as is the current state of humanity, it becomes distorted into the pressure to feel happy. Thus begins what the ancients named the Wheel of Samsara — an endless cycle of suffering in which humans become trapped by the need to satisfy their desires. With the mass distortion of the 415' Shadow, it is as though the body of humanity has misread the instructions left within its collective DNA. It all begins here, in this Gene Key. It is not desire itself that is the problem, because desire (the 30¢h shadow) comes after Fantasy. Fantasy is the spark that ignites the fuel of the desire. Over half of your genetic code derives from other organisms from an earlier evolution. So how is it that we h... THE GIFT — Resolve
What are the Gene Keys?
Gene Keys is a system of consciousness transformation created by Richard Rudd, based on Human Design, I Ching, and genetics. Each of the 64 Gene Keys corresponds to a Human Design Gate and describes a spectrum of consciousness from Shadow (low frequency) through Gift (middle) to Siddhi (highest frequency).